gachaCocobeans
gachaCocobeans gachaCocobeans
  • 05-02-2021
  • Mathematics
contestada

please help am i correct

please help am i correct class=

Respuesta :

avah228
avah228 avah228
  • 05-02-2021

Answer:

Yes It is 108

Step-by-step explanation:

Answer Link
jannahc1026
jannahc1026 jannahc1026
  • 15-03-2021

Answer:

yes u right also stop deleting my answers

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
Solve y^2 = -64, where y is a real number
Essay life in a city is boon
Larry rolls 2 fair dice and adds the results from each. Work out the probability of getting a total less than 8.
Simplify (3 + 6x) - 2(x+1) + 5 what's the answer?
A particle in the first quadrant is moving along a path described by the equation LaTeX: x^2+xy+2y^2=16x 2 + x y + 2 y 2 = 16 such that at the moment its x-coor
You are an astronaut in space far away from any gravitational field, and you throw a rock as hard as you can. The rock will: slowly slow down and stop continu
Heme group (carries O.)
Why are genealogies given such an important place in the history of Israel?
One afternoon, the clerk at the customer service desk of a large retail store got bored and started stating different return policies to each customer. Customer