madleenjwaida50
madleenjwaida50 madleenjwaida50
  • 03-11-2019
  • Mathematics
contestada

Does anyone know the awnser to this? My little brother wanted me to help him but both of us can figure it out​

Does anyone know the awnser to this My little brother wanted me to help him but both of us can figure it out class=

Respuesta :

oofityoofoof
oofityoofoof oofityoofoof
  • 03-11-2019

Answer: Everybody will need to pay 3.18 dollars. ($3.18)

Step-by-step explanation:

To find out equal amounts of money, you need to divide the total cost by how many people there are. The total cost, in this case, is 12.72, and the amount of people in this problem is 4 people. That means, if everybody were to pay the same amount, you would need to divide 12.72 by 4.

12.72/4=3.18

Answer Link

Otras preguntas

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
What statement best describes a republic?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
3+1/4x greater than 11
who fought against each other in the crusades?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
find the prime factorization 504