naninanig27 naninanig27
  • 03-09-2020
  • History
contestada

TRUE OR FALSE? The remains of living organisms will usually stay preserved longer in areas with large numbers of bacteria and insects .

Respuesta :

300032555
300032555 300032555
  • 03-09-2020

Answer:

true

Explanation:

Answer Link

Otras preguntas

Why were senators able to amass more power and influence than congressmen during the gilded age?
The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.
The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was
Your religious identity is only important for you within your family and does not matter in the public sphere.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
from what you have heard about modern war
How do you find x ????
The Hellenistic age was characterized by all of the following EXCEPT
What is the French name for the Hall of Mirrors? What is the Avenue Trianon?
What was one of the two major goals that the national organization for women work towards when it was first founded?