screen3405 screen3405
  • 04-09-2020
  • Business
contestada

Patents discourage companies from committing themselves to extensive basic research.A. TrueB. False

Respuesta :

andromache andromache
  • 06-09-2020

Answer:

B. False

Explanation:

Patents may be defines as when a legal authority or permission granting a right for a given time, in particular exclusive and right to exclude others from the production, use, or sale of an invention.

Therefore the given statement is wrong as patents are not discouraging the organizations from carrying out to extensive primary research so, the correct answer is False.

Answer Link

Otras preguntas

what was paul revere failures
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4(3-5)=-2(8-z)-6z what is z
what is 15/24 in simplest form
3+1/4x greater than 11
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
when Jefferson took office he did what