cymred cymred
  • 03-02-2021
  • Biology
contestada

What effect would cleaning up the environment have on the moths?

Respuesta :

Jessie7890 Jessie7890
  • 03-02-2021
the black ones would get eaten since the pollution on would go away so they couldn’t be hidden anymore
Answer Link
notyourtypicalgirl
notyourtypicalgirl notyourtypicalgirl
  • 03-02-2021
what effect would cleaning up the environment have on the moths? an increased in light colored moths
Answer Link

Otras preguntas

When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate
Observing people and asking them questions are the two principal ways to obtain
zimmerman note definition
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the distance between points (-42, 63) and (-39, 67)?
[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of
How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?
Please help ASAP!!!! 100 points!
Everfi the person who receives financial protection from a life insurance plan is called a:
A promissory note Question 12 options: is a written promise to pay. is an oral promise to pay. entitles the maker to a discount. is due in 30 days.