jadalynnstayton1234 jadalynnstayton1234

03-02-2021
Mathematics

contestada

Solve for <6 pls :)) (Picture below)

Solve for lt6 pls Picture below class=

Respuesta :

brennanlew23 brennanlew23

03-02-2021

Answer: 137°

Step-by-step explanation:

If you take the angle that is 43° and take 180°-43°

you get 137° this gives you angle 3 and since angle 3 and 6 are the same, angle 6 will equal 137°

Answer Link

Otras preguntas

Why was gerald ford called the "unelected president"?

Explain the translation process that results in production of a polypeptide

what does a light year measure

The introduction of the Green Revolution in India was intended to

What is the value of x? x = 2 x = 3 x = 4 x = 6

will give thanks and brainliest What is an informed opinion? an opinion that you agree with an opinion that you don’t agree with an opinion that can be argued

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.

How have terrorism and the 9/11 attacks changed the policies of the United States in regards to immigrants and terrorism? Discuss the events of 9/11 and the War

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat