mireoStanetorid mireoStanetorid
  • 03-11-2016
  • History
contestada

What role did warfare play in the various nineteenth-century nation-building efforts?

Respuesta :

Аноним Аноним
  • 10-11-2016
The role did warfare play in the various nineteenth-century nation-building efforts is warfare was glorified   led to nationalism and a common identity. 

Thank you for posting your question here at brainly. I hope the answer will help you. 
Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
2ln(5x)=8 solve for x
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what might be learned from an incorrect hypothesis
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
4.2meters= how many centimeter
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
What was religion like in Shang China?