01-03-2021
Mathematics

contestada

Enter the slope-intercept equation of the line shown below.

Enter the slopeintercept equation of the line shown below class=

Respuesta :

11844151 11844151

01-03-2021

Answer:

m=3

Step-by-step explanation:

Go up 3 and across one to find the slope from the points given.

Answer Link

noahbucci noahbucci

01-03-2021

Answer:

m=3

Step-by-step explanation:

Give the other guy brainliest :)

Answer Link

Otras preguntas

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens

Differences between body composition- risk for heart disease or chronic disease.

Who is largely responsible for the spread of hellenistic culture in the 4th century bc?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What major events led to the establishment of the navy and the department of the navy?

What is the name for the transfer of genetic information from one bacterium to another bacterium by a phage? select one: a. transduction b. translation c. penet

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute

A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle

Which constitutional amendment allowed voting for citizens who were eighteen or older?