elihany elihany

02-04-2021
Mathematics

contestada

Help me what is the total volume I’ll mark brainliest!

Help me what is the total volume Ill mark brainliest class=

Respuesta :

stevekbijoy2342 stevekbijoy2342

03-04-2021

Answer:

600 ft

Step-by-step explanation:

Mark as brainilest

And I'm only 80% sure that is the correct

Answer Link

Otras preguntas

Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?

Which are barriers to seeking mental health treatment? Check all that apply. feeling embarrassed having health insurance dealing with peer pressure having limit

Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba

Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

4 (2x-6)=10x-6. solve for x

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi

Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo

Personal care quiz---when providing nail care it is important to consult a professional true or false