cayleegilliard6247 cayleegilliard6247
  • 02-04-2021
  • Mathematics
contestada

Pls help extra points

Pls help extra points class=

Respuesta :

benhellermann benhellermann
  • 02-04-2021

Answer:

B

the middle one

Step-by-step explanation:

Answer Link

Otras preguntas

How was the battle of bunker hill an american success even though it was a british victory?
Can someone please help me understand this?!?! i dont know what to even do. Write an equation for the line parallel to the given line that contains C. C(4,7); y
Your best friend has been feeling sad for more than two weeks, and you are concerned that he may be experiencing depression. How can you have a positive impact
William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose
True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.
Why do you think James Meredith continued his march, even after he was shot?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the distance between points (-42, 63) and (-39, 67)?
A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle
The brackets are indicating a(n) _____ bond. the brackets are indicating a(n) _____ bond. hydrogen polar covalent single (nonpolar) covalent hydrophobic ionic