azocher26 azocher26

03-07-2021
Mathematics

contestada

Convert 1.5% to decimal and a fraction. Show and explain your method.

Respuesta :

miraswain10 miraswain10

03-07-2021

Answer:

0.015

Step-by-step explanation:

1.5% = means 1.5 per 100 or simply 1.5/100.if you divide 1.5 by 100 you will get 0.015

Answer Link

Otras preguntas

HELP ASAP!! Which United States' president, in addition to Eisenhower, believed the federal government should play a smaller role in the economy? A) Ford B) Ca

Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x

which of the following harvesting methods is used in large farmhouses a)sickle b)oxen trampling c)combine d)thresher

what is the smallest unit that can evolve

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ

A major weakness of the new constitution was the bill of rights. a. True b. False

What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define

Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h

epistrophe literary definition

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat