beatriceevie beatriceevie
  • 04-07-2021
  • Mathematics
contestada

Describe fully the single
transformation which maps
triangle T to triangle U.
-2-
-1
U
-5
-4
-3
-2
-1
0
1
2
3
4
-1

Describe fully the single transformation which maps triangle T to triangle U 2 1 U 5 4 3 2 1 0 1 2 3 4 1 class=

Respuesta :

shreyaharia10
shreyaharia10 shreyaharia10
  • 04-07-2021

Answer:

Rotation 90⁰ clockwise about point (-1,-1)

Answer Link

Otras preguntas

What is the value of x?
The federalist papers were published in 1787 and 1788 to help gain support for
What role did John Marshall serve in the new government? A. Head of Congress B. President C. Chief Justice D. Vice president Answer is C.
Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to
Some puritans wanted to separate from the Church of England
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Exercise has numerous health benefits. It conditions your heart and lungs and helps your body fight disease. Many people believe that exercise can help you look
what was a power given by the articles of confederation
what is x? using the picture below and directions
The tall woman was a (professional) athlete who always (laughed) during scary movies. Choose the two antonyms for the (bracketed words) expert / chuckled skill