msaiesha77 msaiesha77

04-05-2022
Mathematics

contestada

Eight meters is equal to how many centimeters

Respuesta :

SAFIUL303 SAFIUL303

04-05-2022

Answer:

800 Cm

Step-by-step explanation:

bro typa question is that its common sense that 100 cm = 1 meter

Answer Link

jackie438 jackie438

04-05-2022

8 meters is equal to 800 centimeters

Answer Link

Otras preguntas

A town doubles its size every 38 years. If the population is currently 44,500, what will the population be in 152 years?

Hank has a 32% marginal tax rate and has already recognized a STCL of $8,000 and a L TCG of $5,000, both due to the sale of stock. He is considering the sale of

2. What was the outcome of the charge? Was anything accomplished? Explain your answer.

Identify the first simile that Frost uses in the poem "Birches" (Use the exact words of the poem.). Lines: Quote:

Translate the vegetables into Spanish by filling in the missing letters: _as _rd_ra_

Find the areas of the trapezoids. Please help. BRAINLIEST

Two equal mass carts approach each other with velocities equal in magnitude but opposite in direction. Friction can be neglected. If the carts collide completel

As a result of mitosis, in a human body cell, the nucleus of each daughter cell contains _________ chromosomes.

Michael's dad is 30 years of age. He is 2 years more than four times Michaels age m. Write and solve a two-step equation to determine Michaels age. Use x as the

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA