omgAmygonz omgAmygonz
  • 02-03-2017
  • Biology
contestada

The density of the liquid and solid states of a substance are often similar. explain?

Respuesta :

jamesbeargr
jamesbeargr jamesbeargr
  • 02-03-2017
In most of the cases, density is closely related to the amount of force between the atoms/molecules of a substance and because this force is almost a constant, the density of its liquid or solid state will be similar. The only difference would be an increase in the temperature when the substance is in it's liquid state, but even in this case, since the basic molecular or atomic or ironic forces are the same, perhaps a little lesser, the density would be comparable.
Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What happened to the steel workers union members?
The following metals are listed in order of reactivity (most reactive first)sodium > magnesium > zinc > coppera) Describe what each metal does when(i)
what is a linear equation??
A newborn baby weighs 2900 grams. How many pounds does this baby weigh? Also how many pounds, how many ounces
HELPPPPPPPPPPPPPPPPPP
two variables are said to be negatively associated if
Topic/what am learning: fraction operations Question: Sarah ran 4 7/8 miles, then walked 11 1/2 miles. Find the total distance she traveled. i need a answer by
Please help, this is physics and I'm having somee issues its to find moments
Self study is good or not good?why?​