KatCanara KatCanara

03-05-2017
Mathematics

contestada

estimate the area of the circle use 22/7 (fraction) as pie

$estimate the area of the circle use 227 fraction as pie class=$

Respuesta :

Lupafel Lupafel

03-05-2017

The area of a circle is pi*r^2
22/7*14^2=616
The answer is 616 cm^2

Answer Link

Otras preguntas

When the term F.O.B. shipping point is used, title passes when the

You can calculate triangle area when you know all three sides by using Heron's Formula. You can also use a formula discovered by the Chinese which I found in W

Read each verbal expression Then assign a variable and distribute

Classify this triangle... sides 4 ,7, 10

What law required Northerners to assist in the return of runaway slaves

At age 76 years, which chronic condition is elizabeth most likely to have?

Exercise has numerous health benefits. It conditions your heart and lungs and helps your body fight disease. Many people believe that exercise can help you look

Express the area of a rectangle with length 7ab and width 2a as a monomial.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Do cones and polyhedrons both have only one base true or false