bstarnault bstarnault

03-01-2018
Mathematics

contestada

Determine if the following graphs are functions

Determine if the following graphs are functions class=

Respuesta :

03-01-2018

the first and the last ones are tge only functions

Answer Link

linnikmia linnikmia

11-12-2018

Answer:

yes, no, no, yes

Step-by-step explanation:

i am on this test so please let me know if i am wrong :)

Answer Link

Otras preguntas

What does the lambic system do? A. registers feelings, such as fear and pleasure B. directs incoming sensory messages C. coordinates involuntary muscle movemen

Which option would best fit in this diagram in the bubble labeled 1?

can anyone help me to solve these 2 questions please I need very clear steps !!!!

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

What does this passage suggest about truman's reasons for declaring his doctrine? he thinks the doctrine is necessary to protect the united states as well as ot

What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis

PLEASE I BEG YOU, HELP ME!!!!!!!! Find the rate of change of the function h(x) = 2^x on the interval 2 ≤ x ≤ 4. The rate of change is what?

The basis of freedom of religion is found in which two principles in the bill of rights

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of these hormones does not help control fluid balance during exercise?