emararose emararose

02-02-2018
Computers and Technology

contestada

Which computer network component allows data transfers from one computer to another through a telephone line?

Respuesta :

IvanMoungang IvanMoungang

03-02-2018

A Router transfer data packets from one node to another node in a network.

Answer Link

zakthompson78 zakthompson78

18-02-2019

*****ON PLATO*****

Dennis answered that it was a modem. Is the correct answer.

Answer Link

Otras preguntas

a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?

zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?

Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the

When did christianity become the official religion of the roman empire?

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which section of an article would you look at to find out if assessors were blinded to treatment assignment?

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

With respect to their direct effects on osseous tissue, which pair of hormones has actions that oppose each other?

what was a power given by the articles of confederation